adding verkko version 2.2.1

[erinyoung]

There's a new version of verkko!

According to the release notes there appears to be some bug fixes.

I copied the files from 2.2, updated the version ARG and base and then expected everything to run.

When I tried to run the tests in gitpod, I ran into the following error:

> [test 4/5] RUN verkko -d asm --hifi ./hifi.fastq.gz --nano ./ont.fastq.gz &&    head asm/assembly.hifi-coverage.csv &&    head -c 1000 asm/assembly.fasta:
0.695 /opt/conda/bin/verkko: 21: [[: not found
0.695 /opt/conda/bin/verkko: 25: [[: not found
0.695 /opt/conda/bin/verkko: 29: [[: not found
0.695 /opt/conda/bin/verkko: 29: linux: not found
0.695 /opt/conda/bin/verkko: 33: [[: not found
0.695 /opt/conda/bin/verkko: 37: [[: not found
0.695 /opt/conda/bin/verkko: 41: [[: not found
0.695 /opt/conda/bin/verkko: 45: [[: not found
0.695 /opt/conda/bin/verkko: 49: [[: not found
0.698 /opt/conda/bin/verkko: 60: [[: not found
0.698 /opt/conda/bin/verkko: 64: [[: not found
0.698 /opt/conda/bin/verkko: 68: [[: not found
0.698 /opt/conda/bin/verkko: 68: linux: not found
0.698 /opt/conda/bin/verkko: 73: [[: not found
0.698 /opt/conda/bin/verkko: 77: [[: not found
0.699 /opt/conda/bin/verkko: 81: [[: not found
0.700 /opt/conda/bin/verkko: 86: bc: not found
1.213 Launching release v2.2.1
1.213 Using snakemake 7.32.4.
1.455 Resource definiton must contain an integer, string or python expression after the identifier.
1.455 
1.522 ls: cannot access '.snakemake/log/*': No such file or directory
1.532 Verkko logging for failed commands: 
------
Dockerfile:45
--------------------
  44 |     # verkko test run
  45 | >>> RUN verkko -d asm --hifi ./hifi.fastq.gz --nano ./ont.fastq.gz &&\
  46 | >>>     head asm/assembly.hifi-coverage.csv &&\
  47 | >>>     head -c 1000 asm/assembly.fasta
  48 |     
--------------------
ERROR: failed to solve: process "/usr/local/bin/_dockerfile_shell.sh verkko -d asm --hifi ./hifi.fastq.gz --nano ./ont.fastq.gz &&    head asm/assembly.hifi-coverage.csv &&    head -c 1000 asm/assembly.fasta" did not complete successfully: exit code: 1

I don't normally run verkko, so this will take some time on my part to solve unless someone else knows what to do about this.

The full diff (thus far):

$ diff build-files/verkko/2.2*/Dockerfile
1c1
< FROM mambaorg/micromamba:2.0.5-ubuntu22.04 AS app
---
> FROM mambaorg/micromamba:1.5.9 AS app
3c3
< ARG VERKKO_VER="2.2.1"
---
> ARG VERKKO_VER="2.2"
9c9
< LABEL base.image="mambaorg/micromamba:2.0.5-ubuntu22.04"
---
> LABEL base.image="mambaorg/micromamba:1.5.9"
49d48
< RUN micromamba list
\ No newline at end of file

Pull Request (PR) checklist:

• Include a description of what is in this pull request in this message.
• The dockerfile successfully builds to a test target for the user creating the PR. (i.e. docker build --tag samtools:1.15test --target test docker-builds/build-files/samtools/1.15 )
• Directory structure as name of the tool in lower case with special characters removed with a subdirectory of the version number in build-files (i.e. docker-builds/build-files/spades/3.12.0/Dockerfile)
  • (optional) All test files are located in same directory as the Dockerfile (i.e. build-files/shigatyper/2.0.1/test.sh)
• Create a simple container-specific README.md in the same directory as the Dockerfile (i.e. docker-builds/build-files/spades/3.12.0/README.md)
  • If this README is longer than 30 lines, there is an explanation as to why more detail was needed
• Dockerfile includes the recommended LABELS
• Main README.md has been updated to include the tool and/or version of the dockerfile(s) in this PR
• Program_Licenses.md contains the tool(s) used in this PR and has been updated for any missing

[kapsakcj]

I don't run verkko myself, but those errors kind of look like it's trying to bash integer expression e.g. [[ a + b]] or something like that. Might also require bc to be installed? perhaps try apt install bc?

another possibility is that this tool requires the /bin/bash shell instead of the default /bin/sh? could try adding dockerfile instruction SHELL prior to running the test. Could try this:

docker-builds/build-files/ska2/0.3.7/Dockerfile

Line 33 in 21ca0e0

SHELL ["/bin/bash", "-c"]

[erinyoung]

@kapsakcj , defining SHELL didn't help, BUT installed bc appears to have done the trick.

Thank you for the recommendation! This PR is now ready for review.

#12 459.6 Reading graph from stdin
#12 459.7 [Wed Feb 26 22:42:24 2025]
#12 459.7 Finished job 0.
#12 459.7 60 of 60 steps (100%) done
#12 459.7 Complete log: .snakemake/log/2025-02-26T223445.586037.snakemake.log
#12 459.7 node	coverage	length
#12 459.7 utig4-0	23.78	3421198
#12 459.7 utig4-1	7.67	4526
#12 459.7 utig4-2	8.00	4518
#12 459.7 >contig-0000001
#12 459.7 CCATCATGACCTGGTGTATCGGCAACGTGGTCGGCAAAACCATTCCGGGTAACGATGATGTGGTGAAGCCCGTCAAGGAGCAGGCGGAAAACAAAATCGATGGTGCAGTTGCGCTGATTATGGCGGTTGGCAGAGGCCATGCTGTACGAGAAAGAAGACACGCTGTCTGATCACATTGAGTCCTACGGGATCCGCTCGCTTTAACTGAGGTAATTATGATCATGCTGATTCTCGCGCCTCTGGTGGGCGTGCTGGGTGCGCTTTTGCTGGCGTATGGTGCCTGGCTGATTTATCCCCCGGCGGGTTTTGTTGTTGCCGGGGCGCTGTGCCTGTTCTGGTCGTGGCTGGTGGCGCGATATCTCGACCGTACACAGTCGTCTGTCGGCGGAGGTAAATAGTGTTCTTTTCGGGATTATTTCAACGAAAAGTGACGCACCGGTGACCACGCCAGCAGAGCTGGCGGATGCCATCGGGCTGTCGTATGACACCTATACCGGAAAGCAGATCAGCAGTCAGCGGGCTATGCGACTGACGGCGGTTTTTTCCTGCGTCAGAGTGCTGGCAGAGTCGGTCGGGATGTTGCCCTGCAATCTGTATCACCTGAACGGCAGCCTGAAGCAGAGAGCCACCGGCGAACGTCTGCATAAACTGATCTCCACGCATCCCAATGGCTATATGACGCCGCAGGAGTTCTGGGAGCTGGTGGTCACCTGTCTGTGCCTGAGGGGAAACTTTTACGCCTACAAAGTGAAAGCATTTGGCGAAGTGGCTGAACTGCTGCCCGTCGATCCCGGCTGTGTGGTATATGCGCTGGGAAGGTGTCAGCGATGGCCTGAAGGTGACCGCCGGGAGTGTTATTCAGCGCGATGACCTGGTGCAGTACACGACAACTGACGATGCAACCAGCTCCGGTGGTGTCCTGCGCGTGCCGATCGCCTGCTCAAGTGCAGGTGCGGTCGGTAACGCTGACGACGGTACGGCATT
#12 DONE 459.7s